Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E367840

Search information 
Request: 367840Match: SGN-E367840
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175935Clone name: TUS-22-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175935 is on microarray TOM1 spot ID 1-1-4.3.11.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17420 [cLED-19-J8] Trace: SGN-T53657 EST: SGN-E237743 Direction: 5' Facility: TIGR
Clone: SGN-C175935 [TUS-22-K5] Trace: SGN-T180455 EST: SGN-E367841 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367840Length: 633 bp (935 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E367840 [] (trimmed) AGTACTTAGATACTTTATTATTATTAAAAGATACATAACAATAACAACTAAGAGAAATAACATACAAAATAAATAGATGATCAAGTGCACATAAC
TAATTGTATTTGCTTTACACTTTCAATCCAAATTTCCAACTTTTCCAATCCTCAAGTAAATAGGATAAATCACTTTTTTCTCACTCTTCCCATCT
TCATTCCAAGCACTTGTAAATTTTTCAACAACATCTTCACTTAACAACTCAACACCCTTTTCTTTTGCAGTTTGATAAGCTGACCATGACTTCAA
GTATGTAAAACAAGAATCCAAGTCCATAACTTTCTCAATCTTGAACTCAAATGGTCCATTATGATCACATCCATCTATAGCCTCAAATGGAAAAT
CAATAGTTTCATACTTTTCATCGACCAATTTTCTTGGTGATTCCCAATAAGGTCCAGCATCACTTGTGTAAAATTTATCAAATATTGCATCTACT
GAGTTGTTTATTTTAGGTGTAGTGTAACACCATGATGCTATAACACCATTTGGTTTCTTGAGTAACCATTTAACATGTTCATAAAAAGTTGGTAG
ATCAAACCAATGCATTGCTTTGTGCAATTGTTACTAAAATCTACACTTGATTCTGATCCTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367840] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180454 [Download][View] Facility Assigned ID: FA0AAD10AF03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5