Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E367975

Search information 
Request: 367975Match: SGN-E367975
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176013Clone name: TUS-22-N11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176013 is on microarray TOM1 spot ID 1-1-6.2.11.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C18692 [cLED-24-E9] Trace: SGN-T54787 EST: SGN-E240890 Direction: 5' Facility: TIGR
Clone: SGN-C176013 [TUS-22-N11] Trace: SGN-T180725 EST: SGN-E367976 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367975Length: 686 bp (938 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E367975 [] (trimmed) GGTAGATAAATGGAAGATTGTATTTAGAATTCGAATACACTTAGGATCGACTATCTGAATCCTTACTGCTTCATTTAAGCTCAACTCATGTCATC
ATCGTTATCAAATAAAGTAAAAGCGAGGGGGAAAAAACAAGTTTTAATAACGTTAGACGTTCTCCAACGAGCCCCGAACGAGGACAATGTGATTT
CATTTGCAGTGCAAGAGTCAGTATCAGACCTGATAGAAGTAACTTCAGAAAACCAGGTTGTCTTGGCTGTGGTAGTATACTCTCTCCATTCAACA
TCAGAACCACGACCGACATATTTGGTCTGTCTTCTGGAATCTGCTGGACACATAACAGACTAACATGAATGCACCGCGATATTTCAAACATAAGA
TCGTGTGTGTCCTCTAACGAGGAATCAACTAACGCGAGGGGTGTCCCTTGCATCCACATTCTCCGTGCATATTCTATAAGACCGTGATGATGATG
TGGATGACGGAAGCATCTATTCCTCTTTCCGATTAGATTTCCAACAATAGCAAACCGAAACTGAAGACATCAGATCTTACTGAAAATAGACCATA
TAGCGCATATTCTGGAGCCATATAGCCACTGCAAATGATAAGCTAATAAAATTACATGACAGATATGGATGTGTCATGGATGTAATTTATGGCAC
TGTTTAAACTTACAAAGTTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367975] SGN-U586593 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180724 [Download][View] Facility Assigned ID: FA0AAD10CG06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5