EST details — SGN-E368146

Search information 
Request: 368146Match: SGN-E368146
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175836Clone name: TUS-22-G2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175836 is on microarray TOM1 spot ID 1-1-7.3.11.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16897 [cLED-17-O23] Trace: SGN-T52949 EST: SGN-E238507 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368146Length: 418 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E368146 [] (trimmed) TCTTCTTCTCAATCTGTAAAAATGGGGTCTATTATCACTATCTTCTGCAGCATCACTTCTTCATCAGCGTCAACAATGGTGGCTCAGAGGAAACT
TCCAATTTTGCTTTTTGAAGTTATGGATACTATTGTTTGCGACCCTTTTTACCATGATGTCCCTGCCTTCTTCAAAATGTCAATGAAAGAATTGC
TGGAAAGCAAGCATTCAACTTACTGGATTGAGTTTGAAAAAGGCCTTATCAGTGAGGAGGAGTCGACTAGGAAATTCTTCAAGGATGGAAGATCT
TTTGATATGGAAGGTCTCAAAAACTGTATGAGAAGACGATATTCCTACCTTGAAGGTGTTGAAGGATTATTGAATTCTTTGAAAAAAAATGGCTA
TGAAATCCATGCTTTCACAAATTATCCAATCTGGTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368146] SGN-U567111 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180625 [Download][View] Facility Assigned ID: FA0AAD10BD01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0333 Quality Trim Threshold: 14.5