Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E368211

Search information 
Request: 368211Match: SGN-E368211
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177332Clone name: TUS-26-E10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177332 is on microarray TOM1 spot ID 1-1-7.1.7.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37216 [cLEG-41-G2] Trace: SGN-T71918 EST: SGN-E258886 Direction: 5' Facility: TIGR
Clone: SGN-C177332 [TUS-26-E10] Trace: SGN-T182345 EST: SGN-E368212 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368211Length: 521 bp (952 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368211 [] (trimmed) AAAAGGGTTAAAGTAGCTCCGGCTACGATACGAAAAAACAATATTAATGTTTTACATTGCAAGCAAAGTAGCAACTAACCAAAGCATGAAAAGGG
AAAGAAATGCAGGATATTTTTCAGAAATTGATCTTCTTTCTATCCAAAATAACCAAACGGTGTTTAACATCTATACTCCAGATATAGGTAAGCGA
GCGACAAGCGAGGGCAGAATCTAATTGATGCTCTAAGCCTTGTTTGAAATATTGTTCGATAGCCAATCAAGTCCCTCGTATAACCCTTCTCCAGA
AGTGGCACATGTACTCTGGATATACCAGTGCCTCTGTCGAAGAGAATGAAGTCCAAGTTTGTCGGTGATTTCAGCTGCATTCATTGCGTTTGGAA
GATCTTGTTTGTTTGCAAAAACAAGCAGCACAGCCTCTCTTAGTTCATCCTCATTCAACATCCTATGAAGCTCGTCCCTTGCCTCAACAACACGG
TCTCTGCCATTGCTGCCAACCACAAAGATGAGGCCTTGAGTGTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368211] SGN-U580474 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182344 [Download][View] Facility Assigned ID: FA0AAD14BC05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5