EST details — SGN-E368298

Search information 
Request: 368298Match: SGN-E368298
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177434Clone name: TUS-26-I16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177434 is on microarray TOM1 spot ID 1-1-1.1.6.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37434 [cLEG-42-A3] Trace: SGN-T72198 EST: SGN-E259437 Direction: 5' Facility: TIGR
Clone: SGN-C177434 [TUS-26-I16] Trace: SGN-T182432 EST: SGN-E368299 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368298Length: 624 bp (951 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368298 [] (trimmed) ACTAGTTCTCTCGAAGATCTGGTTCCCGGCACCGTTCTTCACGCTCTAGAGTAATACCTGTTGCTGGATCTGGTGATAGTGCTGTTCCCATTAAC
ATTGCACATAATGAAAGTGATTCTCAAGCTCTTATGAGTCGGTTCCAGTCAGAGATAGCTACTTCCCTGACTGCAGCAGCTTCTTCTGAATTACC
TTGTACTGTGAAACTCAGAGTGTGGCCTTATGATATTAAGGTTCCATGTGCGCCGCTTGATGCTGAAAAATGTCGCTTAATTATACCACATGCTG
TGCTCTGTAGTGAAATGGGTGCCCACTTTTCACCATGTGGAAGATTTTTAGCAGCTTGTGTTGCTTGTATTAGTCATGGCATGGAAGCTGATCCT
GGTTTCCATGGACAATTTCGTCACGATGCTGCAACTTCACCTACCAGACATCCAATTGCAGCCCACCCGGTTATGTATGAGCTACGTATATATTC
CTTGGAGGAGGCAAATTTTGGTAGGGTGCTTGCATCTCGACTAATTAGAGCTGCTCATTGTTTGACTTCAATTTCAGTTCTCTCCAACTTCTGAG
CATCTTTTACTTGCCTATGGACGTCGCCATGGATCACTTCTGAAAAAGTATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368298] SGN-U583184 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182431 [Download][View] Facility Assigned ID: FA0AAD14BE08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0