EST details — SGN-E368302

Search information 
Request: 368302Match: SGN-E368302
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177468Clone name: TUS-26-K2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177468 is on microarray TOM1 spot ID 1-1-7.3.7.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37498 [cLEG-42-E11] Trace: SGN-T72375 EST: SGN-E259614 Direction: 5' Facility: TIGR
Clone: SGN-C177468 [TUS-26-K2] Trace: SGN-T182436 EST: SGN-E368303 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368302Length: 298 bp (914 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368302 [] (trimmed) AGACTGAAATTTGAAACTACCAGCTGAAAATCCACCATTAACAAGAATGATCTGACCAGTAATATGTGAAGCAGCAGGGAGACAAAGAAATGCAA
CCAATGGAGATATCTCATCAGGTTCTGCTATTGGTTTCAATGGGGTTTTACACATGAATTCTGAATAATTTCCTACCAATGACGGGTCAATATCC
TTTCGTTTTCAAAATACTAGATTTGACAGCGAATGGAGAGACTGTTTTTACGCGAATTTCATTATTTTTTTTATTCGCATGCCAAAAACTTGGTA
GGTTGGCTGATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368302] SGN-U569123 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182435 [Download][View] Facility Assigned ID: FA0AAD14BF01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0269 Quality Trim Threshold: 14.5