EST details — SGN-E368997

Search information 
Request: 368997Match: SGN-E368997
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176869Clone name: TUS-25-B3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176869 is on microarray TOM1 spot ID 1-1-6.2.8.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28056 [cLEF-46-G7] Trace: SGN-T61768 EST: SGN-E247357 Direction: 5' Facility: TIGR
Clone: SGN-C176869 [TUS-25-B3] Trace: SGN-T181949 EST: SGN-E368996 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368997Length: 679 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E368997 [] (trimmed) CCGGTCCATCTACTTTTTTCTCCTCTGTATTTCAGAAGAAAAGGTTAACTATGGGTAAGGCAAAAAAAAATATTGAAAACATGGAGGAAGGAACC
CTGGAGGTTGGAATGGAATACAGGACTGTCTCTGGTGTTGCTGGACCACTGGTTATCCTTGAAAAAGTTAAGGGACCTAAGTACCAGGAGATTGT
TAATATTCGTTTGGGAGATGGAACAACCCGACGTGGACAAGTTCTGGAAGTTGATGGGGAAAAAGCTGTCGTTCAGGTTTTTGAAGGAACATCTG
GAATTGACAACAAATACACAACTGTGCAGTTTACTGGGGAGGTTTTGAAGACACCTGTCTCACTCGATATGCTTGGACGCATATTTAATGGTTCT
GGAAAGCCAATTGACAATGGTCCTCCTATTTTACCTGAGGCTTACAGGGATATTTCTGGAAGTTCTATCAACCCCAGTGAGAGAACATATCCTGA
AGAGATGATACAGACAGGAATTTCAACAATTGACGTCATGAATTCAATTGCTAGAGGGCAGAAAATTCCTCTATTCTCTGCTGCTGGTCTTCCTC
ATAATGAAATTGCGGCTCAGATCTGCCGACAAGCTGGTTTAGTGAAGAGGTTGGAGAAATCTGAAAATCTTCTTGAGGACAGTGAAGCGGACAAT
TTTGCCATAGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368997] SGN-U579217 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181950 [Download][View] Facility Assigned ID: FA0AAD13CA02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5