EST details — SGN-E369035

Search information 
Request: 369035Match: SGN-E369035
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177069Clone name: TUS-25-J11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177069 is on microarray TOM1 spot ID 1-1-6.2.8.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28930 [cLEF-49-K17] Trace: SGN-T62514 EST: SGN-E249006 Direction: 5' Facility: TIGR
Clone: SGN-C177069 [TUS-25-J11] Trace: SGN-T181989 EST: SGN-E369036 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369035Length: 662 bp (948 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369035 [] (trimmed) AGTTTTAAATTTTCCCAAAAATTTCAAAAATGAAAATTTTGATTTTCCTAATAATGTTTCTTGCTATGTTGCTAGTAACAAGTGGGAATAATAAT
CTAGTAGAGACAACATGCAAGAACACACCAAATTATAATTTGTGTGTGAAAACTTTGTCTTTAGACAAAAGAAGTGAAAAAGCAGGAGATATTAC
AACATTAGCATTAATTATGGTTGATGCTATTAAATCTAAAGCTAATCAAGCTGCTAATACTATTTCAAAACTTAGGCATTCTAATCCTCCTCAAG
CTTGGAAAGATCCTTTGAAGAATTGTGCCTTTTCGTATAAGGTAATTTTAACAGCAAGTATGCCAGAAGCAATAGAAGCATTAACAAAAGGTGAT
CCAAAATTTGCAGAAGATGGAATGGTTGGTTCTTCTGGTGATGCACAAGAATGTGAAGAATATTTTAAAGCTACAACTATTAAATATTCACCACT
TTCTAAATTAAATATAGATGTTCATGAACTTTCTGATGTTGGTAGAGCCATTGTAAGAAATTTATTGTAATATGTCATGTCATAATGTTACATAT
CGAAAAGTTTTTATAGTTTAGTTTGATAGACTGTCTGAATTATTATTTTATTCTTGCTAGTAAAAATTCGATTCGTCACATTATGATCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369035] SGN-U579697 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181988 [Download][View] Facility Assigned ID: FA0AAD13CE06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0009 Quality Trim Threshold: 12.5