Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E369036

Search information 
Request: 369036Match: SGN-E369036
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177069Clone name: TUS-25-J11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177069 is on microarray TOM1 spot ID 1-1-6.2.8.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28930 [cLEF-49-K17] Trace: SGN-T62514 EST: SGN-E249006 Direction: 5' Facility: TIGR
Clone: SGN-C177069 [TUS-25-J11] Trace: SGN-T181988 EST: SGN-E369035 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369036Length: 643 bp (956 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E369036 [] (trimmed) TTTTGATCATAATGTGACGAATCGAATTTTTACTAGCAAGAATAAAATAATAATTCAGACAGTCTATCAAACTAAACTATAAAAACTTTTCGATA
TGTAACATTATGACATGACATATTACAATAAATTTCTTACAATGGCTCTACCAACATCAGAAAGTTCATGAACATCTATATTTAATTTAGAAAGT
GGTGAATATTTAATAGTTGTAGCTTTAAAATATTCTTCACATTCTTGTGCATCACCAGAAGAACCAACCATTCCATCTTCTGCAAATTTTGGATC
ACCTTTTGTTAATGCTTCTATTGCTTCTGGCATACTTGCTGTTAAAATTACCTTATACGAAAAGGCACAATTCTTCAAAGGATCTTTCCAAGCTT
GAGGAGGATTAGAATGCCTAAGTTTTGAAATAGTATTAGCAGCTTGATTAGCTTTAGATTTAATAGCATCAACCATAATTAATGCTAATGTTGTA
ATATCTCCTGCTTTTTCACTTCTTTTGTCTAAAGACAAAGTTTTCACACACAAATTATAATTTGGTGTGTTCTTGCATGTTGTCTCTACTAGATT
ATTATTCCCACTTGTTACTAGCAACATAGCAAGATACATTATTAGGAAAATCAAACTTTTCATTATTGAAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369036] SGN-U579697 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181989 [Download][View] Facility Assigned ID: FA0AAD13CE06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0050 Quality Trim Threshold: 12.5