EST details — SGN-E369192

Search information 
Request: 369192Match: SGN-E369192
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176318Clone name: TUS-23-K4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176318 is on microarray TOM1 spot ID 1-1-5.3.11.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26436 [cLEF-40-G19] Trace: SGN-T59938 EST: SGN-E246086 Direction: 5' Facility: TIGR
Clone: SGN-C176318 [TUS-23-K4] Trace: SGN-T181231 EST: SGN-E369193 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369192Length: 548 bp (937 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369192 [] (trimmed) AAAAGGAAAAAATCAACTGCATTTTACAAATCCATATTATCAAACTTCATACCCATAAGGCACATACATATGCCCTTACATACAAAAATATCAAA
TACAGTACTAACAATTATCCTTCAAAATCCAAAAAAAACAAAAGTGAAGGAAATGAAAAACACTTAAAAACCAAAACAACACAAAAACACAATCA
TAACATCCCAAAAGTAAAATTAAAAAAACATTTCATTTCATTTAGTCTTTTTCCTTCTCCTTTTCCTTTTCAGCCTTTGAGGGGTATCCTGGAAA
TTTCTCCTTAATTTTGTCCAAAAATCCCTTTTTTTCCTTCCCCTCCGCCTAATGCTCCACCGAAGCCGGGGGGGGGGGGGGGGGGGCCCCCACTT
CCTCCGTTTTTTTATGCCCCCCACCTGGCAATTTTTCTTTAATTTTGTCTAAAAATCCTTTTTTTTCCTTTGTTTCCTCGAATTTCCTCAACTGG
AACTGAGGTATCCTTTGTTTTTGATTTTTCCTTGGGAACACCAGATATTTTTTCCTTAATTTTATCCTTTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369192] SGN-U581410 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181230 [Download][View] Facility Assigned ID: FA0AAD11BF02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.886 Expected Error Rate: 0.0223 Quality Trim Threshold: 14.5