Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E369213

Search information 
Request: 369213Match: SGN-E369213
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176414Clone name: TUS-23-O4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176414 is on microarray TOM1 spot ID 1-1-5.3.11.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26694 [cLEF-41-E24] Trace: SGN-T60416 EST: SGN-E247001 Direction: 5' Facility: TIGR
Clone: SGN-C176414 [TUS-23-O4] Trace: SGN-T181252 EST: SGN-E369214 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369213Length: 709 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369213 [] (trimmed) CAATGCTCAAAACAAACAAGCTAATTGAATTTATATTGGTATGGAACTCGCAAAAAAATGTATTTCTCACGCAAAATACGCGTAGAAATGCTACA
AACCCACCCCCATCCTTACCCGCACCCCACCCTCCGAAAAAAAAAAAGGCGGTATAAAAAGAGAATAGCTATACCTTTTACACATTACTACAAGA
ACTTTTAAGCTAAAATTTCTAATGCATATACAAGTTAATATCTTGTATTATATAGTAGAGAGAATTTATGAGGAACATGAAAGCATGCCTACACC
GGGACGATAAGCCCAAGCTGGAGGCAGACGCGCATACTTCTCCATGCCAGGTTGTTCGTCAAATGGACGTTGCATGACTTTCAGTAGTCGTCTGA
CCTCCCCAAAATCGTCTTGTTCAGCTGCATCTATTGCACTTTGGCATAAATAGTTTCTAAGGATGTACTTTGGATTAACAGAATTCATCGAGGCC
TTCCTCTCATCGTCTGATACACCGATAGTAGAGAGCTCCTGTATGTAGGATTTCACCCAGCTTGTCCAAGCTTCCTTGCGCTCCTGACCAATATC
CAATAGCGCAGCTTTGAGAGGAATCAGTAACTGGTTATCTGGAATTGTAGGATCGGCTTTGATGTTTGATAGTAATCGGAAGAAGTTTGTGTAAT
CAACTTTATCGACAGCCATATTCTTAAGTAGTTCACCAATCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369213] SGN-U582267 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181251 [Download][View] Facility Assigned ID: FA0AAD11BH02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5