EST details — SGN-E369227

Search information 
Request: 369227Match: SGN-E369227
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176854Clone name: TUS-25-A12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176854 is on microarray TOM1 spot ID 1-1-5.1.8.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28017 [cLEF-46-F1] Trace: SGN-T61566 EST: SGN-E247155 Direction: 5' Facility: TIGR
Clone: SGN-C176854 [TUS-25-A12] Trace: SGN-T1428 EST: SGN-E378267 Direction: 5' Facility: Giov. Lab
Clone: SGN-C176854 [TUS-25-A12] Trace: SGN-T181718 EST: SGN-E369226 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369227Length: 681 bp (927 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E369227 [] (trimmed) AGAAGCTCCGGCTTTCTTTGCTGATAATCTTATGGGAGATTCTCCAAAGAAAGTCGATTCGAAATCGAAGGGCATTGAAACGGCTATTGTTGTTG
GGAGTAAAATATATGTGATTGATGGGGTTGATCATGAATTGGGGTCGACTGTTGGAGTTCGAATCTTTGATAAGTCTACTGGGGAATGGAGAATC
CCTATTGTGTTGGGAACAAAACCCAAGCCATCTAAGGACTTCTCAGCTGTGCTTTTAAATGATGATCGTGTGTTAGTTGTTAGAGGGAACTCTGG
TTCTAGTGAATGCTTTTGGTTTCTTGAGGTGGGCACTCCATTTGTTAGAGAACATGAAAAGACTTTAGGGAATGAGGTGGTTGCCTGGAGCAAAG
GAGTTTTAGGCAATGTTGAGAAGCCTATTGTCATTAGTGGCCCTTCTGGAGTGGGTAAGGGCACCCTGATATCAAAGCTAATGAAAGAATTTCCA
TCCATGTTTGGATTTTCCGTGAGCCACACAACTCGAGCACCAAGAGCGAAGGAGCAGAATGGGATTCATTACCATTTTACTGACCGCAATGTGAT
GGAGAGTGAGATAAAGGATGGCAAGTTTCTTGAATTTGCTTCTGTTCATGGTAATCTCTATGGAACAAGTGTAGAAGCTGTTGAGGTGGTTGCTG
ATGCTTGCAAGCGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369227] SGN-U568366 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181719 [Download][View] Facility Assigned ID: FA0AAD13BA06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5