Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E369301

Search information 
Request: 369301Match: SGN-E369301
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176852Clone name: TUS-25-A10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176852 is on microarray TOM1 spot ID 1-1-7.1.8.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28011 [cLEF-46-E4] Trace: SGN-T61541 EST: SGN-E247130 Direction: 5' Facility: TIGR
Clone: SGN-C176852 [TUS-25-A10] Trace: SGN-T181794 EST: SGN-E369302 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369301Length: 761 bp (954 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369301 [] (trimmed) AATATAATGTAAAAGTATATAAATAATAGTAAAACTCTTTTACAAAGAGTCAAAAGACTAGCAAAATAGGGTACAAAGTACAAACTAAAGGTAAG
TTAATGAAACAATACAGAGGTGGAATAATTCCTAAGATATTCAAAACTGAGAATACTCAATGCAACTATAGGAGAAGCCATTTGAAAGTTTAACT
TCACCGATTTCTTGATTTTTTTAGCTTACACAGAGCAGCAACCAACTTTTTTCACAGCTGAAACATCATCCTTGCCAACATTTATAGTTTGCCCC
TTCGGCAACGCAGTAGGATCATCCCCAACTTCGAGTGCTTTCCGACAGACCACCCTGTATATCTCTGTCAGTACTTCTGTAAACGCATTCTCAAC
GTTCAAGGATTCAAGTGCTGAAGTCTCCATATAGAAGGTACTCTCTCTTTCAGCAAAGGCCTTGGCATCCTCTGTTGAAACAGCACGCAAGTGAC
GTAAGTCGGCCTTGTTCCCAACGAGCATTATGACTATATTTTGGTCGGTATGGTCTCGAAGTTCTTTTAACCATCTCTCAACATTTTCAAATGTG
ACATGTCGAGTGATATCGTAGACAACTAATGCACCGACAGCCCCTCTGTAGTATGCACTTGTAATTGCACGATACCTTTCTTGTCCAGCAGTATC
CCAAATCTGAGCCTTAACGATCTTATCATCTACCTTAATGCTACGGGTAGCAAATTCAACACCAATAGTAGACTTTGATTCAAGATTGAACTCGT
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369301] SGN-U564989 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181793 [Download][View] Facility Assigned ID: FA0AAD13BA05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5