EST details — SGN-E369334

Search information 
Request: 369334Match: SGN-E369334
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177036Clone name: TUS-25-I2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177036 is on microarray TOM1 spot ID 1-1-7.1.8.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28880 [cLEF-49-I10] Trace: SGN-T62388 EST: SGN-E248880 Direction: 5' Facility: TIGR
Clone: SGN-C177036 [TUS-25-I2] Trace: SGN-T181825 EST: SGN-E369333 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369334Length: 669 bp (912 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E369334 [] (trimmed) ACGGACTGTGACGGTGGAAAATTGACGGTGAAAGGGAACGTGGATCCGGCATGGCTCCGGGAGAAAGTAGCGATGAAGACGAAGAAGACGGTGGT
GCTCGTTTCTCCTCAGCCTAAAAAGGACGCCGGCGCCGGCGCCGGCGGTGGAGATAAAAAACCCGATGAGAAAAAGGCAGAAGAGAAAAAACCTG
AAGATAAGAAGCCTAAAGAGCCACAAGTAAGTACAGTGGTGTTGAAGATTCGATTGCATTGTGATGGGTGTGCACACAAAATAAAGAGAATTATA
AAGAAAATTGATGGGGTAGAAGAAGTCAAAGTAGATTCGGAAAAAGATTTGGTCAATGTTAAGGGTACAATGGACTTGAAGGAATTAATTCCTTA
TTTGAAAGATAAATTGAAAAGAAATGTAGAAATCATCCCACCTAAGAAAGATGATGGAGGTGGCGAAAAGAAAGAAGGCGGTGGCGGTGGTGAGA
AGAAAGAGAAAGAAGGGGGTGAACAAAAAGCCGAAGGAAGTAAAGGTGTGGAGACAAAGTCCGAAGCGAATAAATTAGAGTATTATGGTTACAAT
GCACAAACACATTACGCGATGCCTGTGTACAACCAAAGTTACATGAATCAAGACTATGGTCTAACAATGTACGATCCCGGTTACAACGCTCATAC
GGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369334] SGN-U565780 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181826 [Download][View] Facility Assigned ID: FA0AAD13BE01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5