EST details — SGN-E369592

Search information 
Request: 369592Match: SGN-E369592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177162Clone name: TUS-25-N8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177162 is on microarray TOM1 spot ID 1-1-1.2.8.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34209 [cLEG-30-C14] Trace: SGN-T69198 EST: SGN-E255472 Direction: 5' Facility: TIGR
Clone: SGN-C177162 [TUS-25-N8] Trace: SGN-T182082 EST: SGN-E369593 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369592Length: 749 bp (917 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369592 [] (trimmed) ACTAGTTCTCCAGAAAGCAAAAGAAGTCAACTTTCTTTACAAAATAATAATTCAATTTAGGGTTTCTATGAAGGGACACAATCCAATTGAGGTGG
CGAAGACGGTGTTGGAGGTGGCCGATGTAGCATGGTCGGCGGTGGAACGCTGTCATCACCATACCCACAGTCATACTGATACGACGTCGTTTGAT
GTATCTCATAGTTGTGAAGAAGATGGATTGAGATCTTTGAGGTCTGAAAACGAACGGCTCAAACGGTTGCTTGAAAAAAATCTTATGCTTCTTCA
GAGCATGTCACAATCTCCTTCCTTACTTCAAAATTGTCCACCTGATCTTCATGAACGTCTCTTAGCCGCTGTGGAATCCGGAAGCTTTTTGAAAC
AGCTGGAAACACTGAATCGGAAATCTGTTGATGGGAATGACTGTCAATTTCCTTTCAAGGAGGCAACTGATGTTGACACGGAGACAGCAGAACTT
CTGGTGAACATGAGTCTTGAAGAACCAAGTTGGTGGGTTTGGGTGACTGAGGATATGGTCCCTGGCAATCTTGAAGAAAGAAGCGAAATAGATAA
TGATAACTATGTGATTGTTAGTGAGGAATATGTTGTAGATGCAGTTGCCAACTTTATGGCTAGATGCGTAGTATCCAATTCGAAGGCTCAGAAGA
TGTCTCCTGAAGAACTGCAAAAGACCCTGGCAAAAGCATTCGAAGGCATTGGTAAAGTAGAAACATTGTTCAACATTTGGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369592] SGN-U570499 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182081 [Download][View] Facility Assigned ID: FA0AAD13DG04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5