EST details — SGN-E369733

Search information 
Request: 369733Match: SGN-E369733
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177043Clone name: TUS-25-I9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177043 is on microarray TOM1 spot ID 1-1-8.1.8.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28894 [cLEF-49-I23] Trace: SGN-T62349 EST: SGN-E248841 Direction: 5' Facility: TIGR
Clone: SGN-C177043 [TUS-25-I9] Trace: SGN-T181594 EST: SGN-E369732 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369733Length: 532 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E369733 [] (trimmed) CTGACTTTTCTAACTTTATTCTTTGACATTTATAATACAGATCTCTATCTTCTTCATTCAATACATACACAATACAATACCAAATACAAGATTAA
TAATATTCTTTCTGCCTAACCTTAAATCTTTGTTTATCAGGTTGAATCTTTTATACAAGGAATACTTACTTACATCTATGGGAGAAGCACCAGCT
TTCTTTGCTGATAGTCTCTTGGGAGATTTTCCAAATGGGATCGATTTGAAATCTAAAGGCCACAAAACAGCTATTTCTATCGGCTCTAAAATTTA
TGTGATTGGCGGGGCTGATCATGAGTCGACAGCGGTAATTGGAGTTCAAATATTTGAGAAATCTAGTGGGGAATGGATAAACCCCACTGTGCTGG
GTACTAAACCCAAGGTCTCAAATGGCCACTCAGCTGTGCTTTTAAATGGTGATCGTATATTGGTTATTAAGGGCAATTCCAAGTCTGATGAATGC
TTTTGGTTTCTTGAGGTGGGCACCTCATTTATAAGAGAACAGGAAAAGACATATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369733] SGN-U568368 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181595 [Download][View] Facility Assigned ID: FA0AAD13AE05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5