EST details — SGN-E369873
Search information |
Request: 369873 | Match: SGN-E369873 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C177399 | Clone name: TUS-26-H5 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C177399 is on microarray TOM1 spot ID 1-1-4.4.7.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C37362 [cLEG-41-N16] | Trace: SGN-T72025 | EST: SGN-E258993 | Direction: 5' | Facility: TIGR |
Clone: SGN-C177399 [TUS-26-H5] | Trace: SGN-T182488 | EST: SGN-E369874 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E369873 | Length: 240 bp (1077 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E369873 [] (trimmed)
GGATAAAGATGTCTTAATATTAATAGCATAAGGCCAAAAATCGTCGGAGTTCATTACTTTATGAAGCCCAATACAAAATTAAACTTAAAACATTG
GTACTAGTAATTATTTATCAAGCATCGCTAAATGAAAATTAAAGCCTAATAAACTCAAAAGTCTTTTTAAAATCTGTATTACCAAATACCAACAT
CCATAAATCCATCTTCAGTAGCAAATCCTCTAAACATTCCATTACAATTA
GTACTAGTAATTATTTATCAAGCATCGCTAAATGAAAATTAAAGCCTAATAAACTCAAAAGTCTTTTTAAAATCTGTATTACCAAATACCAACAT
CCATAAATCCATCTTCAGTAGCAAATCCTCTAAACATTCCATTACAATTA
Unigenes |
Current Unigene builds | |||||
[SGN-E369873] | SGN-U583151 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T182487 [Download][View] | Facility Assigned ID: FA0AAD14CD03FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.868 | Expected Error Rate: 0.0112 | Quality Trim Threshold: 14.5 |