Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E370100

Search information 
Request: 370100Match: SGN-E370100
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177396Clone name: TUS-26-H2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177396 is on microarray TOM1 spot ID 1-1-7.4.7.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37356 [cLEG-41-M9] Trace: SGN-T72073 EST: SGN-E259041 Direction: 5' Facility: TIGR
Clone: SGN-C177396 [TUS-26-H2] Trace: SGN-T182715 EST: SGN-E370101 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370100Length: 515 bp (916 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370100 [] (trimmed) ACGATACAAACAGAAATAAAATGTTAAAACATAAGATATGAGAGAAAATCACTTTACAAACACACGAGCCCTATGTTACATGAGATATATAATAA
GAAGCTAAACCTTTTATACAGCACTAATAATGTACACAAAAAGAATGGAATCCTTGCAGAAATAAACACATTATAATTTGGATCTGTACAATGTA
GATCGATATCAGAGCGATTGAGAGTATCGCGTGTAAGTTTATACTAATCGTGAATCATAATCTCCTGGCAGATTCTGGTTCATGGCCCCTATGTG
ATGAATCAGCTCGATCAAGTCGAATGTCTTTCCATGAGCTTGCGTTTGATGATTTGAGCAACAAGCCTAGAGCTGAAGAACAAGTTGCTCTAACG
ATTGCATCTGTTGAACGACTCATTTTGCCAACAAGCATCCCGAAAACCTGATTGTAGTAATGGGATGATATGTGTTTATCATCGGAGAGAGAAAG
CACGCTGTTGCATAAATAAACCGCATTTGCCTGGACAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370100] SGN-U585770 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182714 [Download][View] Facility Assigned ID: FA0AAD14DD01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0