Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E370251

Search information 
Request: 370251Match: SGN-E370251
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178248Clone name: TUS-28-K14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178248 is on microarray TOM1 spot ID 1-1-3.3.4.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65057 [cLEM-8-D15] Trace: SGN-T85396 EST: SGN-E271845 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370251Length: 597 bp (887 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E370251 [] (trimmed) GCTATCAAGACTAATGTAGTTGGTACTTTGAACATGCTGGGATTGGCTAAAAGAGTCGGTGCGAGGTTTTTGCTAACCAGCACTAGCGAAGTATA
TGGTGATCCTTTAGAACATCCACAGAAGGAGACATACTGGGGCAATGTTAATCCTATTGGTGTCCGAAGTTGCTACGATGAGGGAAAACGAACAG
CTGAAACATTGACAATGGATTATCACAGAGGTGCAGAAGTTGAGGTGAGAATCGCTAGGATCTTTAACACTTATGGACCTCGTATGTGTATTGAT
GACGGTCGCGTTGTCAGCAACTTTGTCGCTCAGGCTTTAAGGAAAGAGCCTTTGACAGTTTATGGTGATGGGAAACAAACAAGAAGTTTCCAATT
TGTTTCATATCTGGTTGAAGGCTTAATGCGGTTGATGGAAGGAGAACATGTCGGACCCTTCAACCTCGGAAACCCTGGTGAATTCACAATGCTTG
AACTTGCTAAGGTGGTCCAGGAAACCATTGACCCAAATGCACAGATTGTACACAAACCAAACACAGAAGATGACCCACACAAGCGAAAACCTGAT
ATCTTAAAGGCTAAAGAGTTATTTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370251] SGN-U582988 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183441 [Download][View] Facility Assigned ID: FA0AAD16BF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5