Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E370406

Search information 
Request: 370406Match: SGN-E370406
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178379Clone name: TUS-29-A1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178379 is on microarray TOM1 spot ID 1-1-8.1.4.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65272 [cLEM-8-N14] Trace: SGN-T85631 EST: SGN-E272080 Direction: 5' Facility: TIGR
Clone: SGN-C178379 [TUS-29-A1] Trace: SGN-T1483 EST: SGN-E378764 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178379 [TUS-29-A1] Trace: SGN-T183812 EST: SGN-E370471 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370406Length: 506 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370406 [] (trimmed) GAGCAAAAGAGCCAAGTGTTTCAACAATGTTGATGAACTTCAGTAATGATTTTGATCCTTATGGTGCCTTAAGTACCCCCTTGTATCAAACATCT
ACTTTTAAGCAACCTTCAGCGACCGAAAATGGGCAATATGATTATACACGGAGTGGAAATCCAACAAGGGATGCGTTGGAAAAGCTTCTTGCAGA
GCTTGAGAAAGCAGATCGAGCATTTTGCTTTACCAGTGGAATGGCCGCCTTGGCAGCTGTAACTCGTCTCGTCAAAGCTGGTGAGGAGATTGTTG
CCGGGGATGACATATATGGTGGTTCTGATCGGATGCTCTCACAAGCTGGGCCAGCTTATGAGATCCTTGACACTTGCGAAACTGCCACTAATACT
GATGTACTTGGTAGCCTCAGTAACATGCTTAGAGAGTGTCAAAGAACCTGTCAGGAAACTCAACACCGATCCTGCACCCGTAGCCTGAGAGAAGT
GCAAAGACCTCCAAGATGGATAGGAAAACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370406] SGN-U584763 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183747 [Download][View] Facility Assigned ID: FA0AAD17AA01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0157 Quality Trim Threshold: 14.5