EST details — SGN-E370640

Search information 
Request: 370640Match: SGN-E370640
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177766Clone name: TUS-27-G12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177766 is on microarray TOM1 spot ID 1-1-5.3.6.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C62111 [cLEM-1-I10] Trace: SGN-T83655 EST: SGN-E270282 Direction: 5' Facility: TIGR
Clone: SGN-C177766 [TUS-27-G12] Trace: SGN-T183014 EST: SGN-E370639 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370640Length: 654 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370640 [] (trimmed) GGGACTTTGTTTGTTGTTTATCAGCTCTACCGATACACTGAACCTTCTCCCTCTTTACTGATAACAGTTCCACATACAAAGAAGGGGCTTACTTG
ATCAGTAGTTTCAAGTAATAAGATAATCTAATTTGATTGTTTGCCTATTTGGCATTGGAGAGATTATGCTAGGCTTGGGCAGGGGAAGAGCTCAA
ACAAGGTCTAGCAGATCTATGTCTCTAGGAGGCATGGATTATGCAGACCCAAAGAAGAAGAGCAATTTTGTGGGTAAAATTCTTATGGCTGCTGT
GCTAACAGCGCTATGCATTCTTATGCTCAAGCAGTCTCCAACTTTTAATACCCCAAGTGCATTCTCTCGCCATCAACCAGGTGTTGTTCATGTCT
TAGTCACCGGAGGTGCTGGCTACATTGGTTCCCATGCAGCATTACGACTTTTAAAAGAAAATTACCGGGTGACGATAGTGGACAACCTTTCACGA
GGAAATATGGGAGCTGTGAGGATTCTGCAGGAATTATTTCCTGAACCAGGGAGGCTTCAGTTTATATATGCTGACTTGGGGGATGCAAAAGTGGT
CCACCAGATATTCTCCCAGAATGCTTTTGATGCTGTGATGCATTTTGCAGCTGTAGCATATGTCGGAGAGAGCACCCTCGATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370640] SGN-U573010 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183015 [Download][View] Facility Assigned ID: FA0AAD15BD06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5