EST details — SGN-E370739

Search information 
Request: 370739Match: SGN-E370739
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178312Clone name: TUS-28-N6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178312 is on microarray TOM1 spot ID 1-1-3.2.4.4 [Order] [Tomato Microarray Database]
See unigene SGN-U580349 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C65169 [cLEM-8-I19] Trace: SGN-T85492 EST: SGN-E271941 Direction: 5' Facility: TIGR
Clone: SGN-C178312 [TUS-28-N6] Trace: SGN-T183672 EST: SGN-E370740 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370739Length: 573 bp (892 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370739 [] (trimmed) GTTGACCCAAGACTTATTTTAATGATATTAGTCTGAAAAAAACATTAGTGATGTAAAGATGAACCTGTCAAAATCATGTGACATCACATTACAAA
AAAGATAAGTCCTGATCTGAACTTTAATAATAGCTAAAGGATGTTTTTAAGTCCCATTCTATGGAGAGTAATAACAGAGGCAATCTCATATAAAA
CTTTTGATGATGAGTTACAACTTTTAAGCAGTAGCACCACTTGCCCCCTTCCCTTTTTTTTTCTGTAGCTTCTTCATGTAAAACTCCAGTTCCTT
GCCCTCCAAGATGTAACCATCAGCACGACCACATTGGCCAGGTCGGGATGAGATTGCCGCCAAAAGACGACCACTAGCAAATTGCTTTTCAATAT
GTGCGTCAATCTTACGATCCTGTTGACGTTTTTCCAGCTTTTTTTGGACATGGTTACTTTTTTTTTCCTTTGCAGCAGCCTCAGCAACCTCCTTT
CCTTTCTTTTTGGCAGCACTTTTTTTCTTGCGACCAATTTCAACACCATAGTGCTGGAGATACCACTGTTTAAATGGAGCTGCATCAACTTGCAC
AAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370739] SGN-U580349 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183671 [Download][View] Facility Assigned ID: FA0AAD16DG03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5