EST details — SGN-E370892

Search information 
Request: 370892Match: SGN-E370892
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177683Clone name: TUS-27-D1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177683 is on microarray TOM1 spot ID 1-1-8.4.6.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47529 [cLEI-16-I2] Trace: SGN-T83224 EST: SGN-E269000 Direction: 5' Facility: TIGR
Clone: SGN-C177683 [TUS-27-D1] Trace: SGN-T183130 EST: SGN-E370893 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370892Length: 635 bp (894 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370892 [] (trimmed) GAACACAAGCAAAGCAAAAAAATCCACATCGCTGTATCAGGGTTACAGAGCTTATGAAGCAATGATCAATTCAAAACATTGCTTCATCAGTGTTA
TTTTGATGAAAAATCTTTCTGAAATAGTCTGATTTTTTTCACATTGGATAAAAGATCATGTAAGAATAAGATTCTATCATACAGAGAACTCTTCA
ACAGTCTCAATCAACATCAAAGCTCTGAAATTTAATTATGACCTGACTTCATATTGCCCAGACCTGGTTAGAGCTCGAAATCCTTTATATGGTCG
GGTAGGTAGATTCTTGAAATCAAGTTTTTCTATTTTCAAACCTGAGAGTGCAACACCCAAAATTTTAAATCCCACAAGAAACGTAGGGAATACAT
GAAGCCGCTCAACTCCTGTTTCCAACACTAATGTTCCAGTCATTGAAGGAGTTTTGTCTTTGGGCATCCTACCAATGGACCAAGTGCATGTCTTG
TTGGAAAGGATGTTTACTGTTCCATAATTTGATGTAAGATCTGCAGATAAAACGCGAGGGGGTAGTTGAAATTGAACGTTTATATCATCAATTGC
CTTCCCAGGATCATTGCGTATCCCAACTAACAAGCTAATACGACATGTCCCTGAGTCTGAAGTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370892] SGN-U576835 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183129 [Download][View] Facility Assigned ID: FA0AAD15CB01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5