Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E370912

Search information 
Request: 370912Match: SGN-E370912
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177779Clone name: TUS-27-H1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177779 is on microarray TOM1 spot ID 1-1-8.4.6.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C62154 [cLEM-1-K17] Trace: SGN-T83714 EST: SGN-E270341 Direction: 5' Facility: TIGR
Clone: SGN-C177779 [TUS-27-H1] Trace: SGN-T183150 EST: SGN-E370913 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370912Length: 611 bp (893 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370912 [] (trimmed) AAGGGGATCGATTTGGCATGCTTGTTAGGGAGATCAATGATCACCTATTTCATGTGGAAGTTATACATACTTAAAATACTACAGTAGGTATCAAC
ATACACAATTCTTGTATACGCGGAAAACCAATTGCAAGGCCCACATTTTCAGGATACAGCAAAATCAAAAGTCAAGCTTCACCCTAAATCAGGAT
TCCACTATTTAAAAGCACAAACCCGAAAGAACAAGTAACAATGTTCAATGTGAGTTCAGGCGTTTTAATTTACAGACGGCAGGGTAATCAGCTTT
GTCCCTCGAAATAGGTTCTTAGTAAGCCTGATCAATCAAAAGGCAAAAGTCCCCACTGAAGAGTACCCAGCGGCCTTGAGATCTTTCAAAGTGCT
TGATAACCAGTCTAGTCCCTCATATAGACCATCCCCTTTAAGAGCACATGCACCTTGTATATGCCATTTCCGGTTTTTAAGATCATAAAGACCGA
GGCCTTCACACACTTCCATTGGAGTCATTGCTCCTTTCATGTCCTGCTTGTTAGCGAAAACCAAGATAACAGCATTAAGCATAAATGGATCTCTA
ATGATTGCCTGAAACTCTTGCTTTGCCTTTCCGATTCTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370912] SGN-U577084 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183149 [Download][View] Facility Assigned ID: FA0AAD15CD01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0054 Quality Trim Threshold: 12.5