Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E370930

Search information 
Request: 370930Match: SGN-E370930
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177875Clone name: TUS-27-L1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177875 is on microarray TOM1 spot ID 1-1-8.4.6.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64175 [cLEM-5-F3] Trace: SGN-T85075 EST: SGN-E271270 Direction: 5' Facility: TIGR
Clone: SGN-C177875 [TUS-27-L1] Trace: SGN-T183168 EST: SGN-E370931 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370930Length: 657 bp (885 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370930 [] (trimmed) CAAAACTTTGATACAGCACCAAAACATACATATATCCCTCTCTCCCTCAACCCTTTATAATTAAAAATAATAATAATAAATATAAAGGTGGGGTA
AGCTTGGATCTTTTTATATAGCCTGAAATTTTTTTTCTTCTTGTTATATTATAATATAAAGTAGGAGATTCATTATCATCTACAAGATTCTTCTC
CACAACATAACAAACCATAATTTTATTTTTATTTTTTTGGTGCAATATACACAAACAAACACATTAAAAGAAGCTTTTTTATCATCAAAATTTGT
ACTGCTACTAGTATTTATTAGTATCTTGTTCAAGTTCAATCAACCATTGATCTTGTTTCTCCTCCATTAAGCACCCATGGATGTCTCAATACTTG
TTCAGCTGAAAATCTTCTGGAAACATCTTTACATATCATCTTCCTCAACAAATCTTTCGCTTCAGGCGAAACTGACCGGAAATTCCTCGTCGGAA
ACCTCAGATTCCCTCTGAGAACAGCTTGAAAAGTTTCAGTCGGCGTTTCACCGTAAAAAGGAGGAACCCCAGAAAGCATAATATACAAAATAACC
CCCAAACTCCACACATCAACTTTCTCATTATACTCTTTCCCCATTAAAACCTCCGGCGCAACGTAATACGGCGTACCCACAACCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370930] SGN-U564187 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183167 [Download][View] Facility Assigned ID: FA0AAD15CF01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5