EST details — SGN-E370934

Search information 
Request: 370934Match: SGN-E370934
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177883Clone name: TUS-27-L9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177883 is on microarray TOM1 spot ID 1-1-8.4.6.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64191 [cLEM-5-G18] Trace: SGN-T85205 EST: SGN-E271400 Direction: 5' Facility: TIGR
Clone: SGN-C177883 [TUS-27-L9] Trace: SGN-T183172 EST: SGN-E370935 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370934Length: 490 bp (949 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370934 [] (trimmed) AGTTCACCCCCGGGAAAAAAACCCCCATTTTACATTCCCATATAAACAACCCTTAAAAAGCAGGGCAGTTTAAAACCCTTATTAGTCTATCCGGC
CCCTAAAATTAACCCTATGGACTCGAAAAAACACAAACCCAACCAAACAGTTTTACTAGACCCAAAAAAATATATATATAGTTAAAAAAGCATTT
TTACTCGAGTCCGGAAAATAAATAAAGCGGGGGCTTCCCCAAGCCCCAAAAAGGGGGGAAAAACCCCTTTTGCTCCAAAAGGGATTCAACAAAAC
CAACAGGGGTTTGGAAAAAGGGAAACCCACTTCCCCCCCCAGCAATATTTGGGGGCCCAAACCCCCCATTTGGGGGGGGGGGACCCCAATATTTG
TCGGATTGGGCCTTTATCACTTAATCAGGCCCAACCAAATCACCCACATGATCCTCCGGGTTTTTGGCGAACACTGACGTTGGCACCCCCCTCCT
TCCAAAAGGGGAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370934] SGN-U604297 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183171 [Download][View] Facility Assigned ID: FA0AAD15CF05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.892 Expected Error Rate: 0.0334 Quality Trim Threshold: 12.5