EST details — SGN-E370943

Search information 
Request: 370943Match: SGN-E370943
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177897Clone name: TUS-27-L23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177897 is on microarray TOM1 spot ID 1-1-2.4.6.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64214 [cLEM-5-H21] Trace: SGN-T85086 EST: SGN-E271281 Direction: 5' Facility: TIGR
Clone: SGN-C177897 [TUS-27-L23] Trace: SGN-T183179 EST: SGN-E370942 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370943Length: 542 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370943 [] (trimmed) GGTTTGAGATCTTACTTCCACGATTTTCTGGAGATATGCTCCCAAAGACCGAAGTTGGGTCTGTTTTGGCTATTACTGATAGGCTTGATAGCATT
GTTGGCTTATTTGCTGCTGGCTGGCAGCCAAGCTCAAGTAATGATCCATTTGGCCTGCGACGGATCTCCTACGGTCTTGTGCAACTCTTGGTTGA
AATTGACAGAAATGTGGACTTACGACAGGCTTTAGAACTTGCTGCTGCAGTGCAACCCATTGAAGTTGATGTCAGTACAATCAATGATGTACATC
AATTTGTAACACGCATACTAAAACAATTTCTGATGGACAAAGGTATAAGCCCAGAAGTCGTTAGGTCTGTTCTTTCCGAGCGTGCAAGACGACCT
GATTTGGCGACTAAGTCAGTGTACAAAATGGAGTCCTTGTCATAAGGGGAGCTTTTGCCTAAGGTTGCTGAAGCATATTCACGTCCAACAAGAAT
TGTTCGCGGGAAGGATGCCAGATGTTGATGTGGAGGTGGATGATCAAGCTTTTGAAACAAATGAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370943] SGN-U585447 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183180 [Download][View] Facility Assigned ID: FA0AAD15CF12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0158 Quality Trim Threshold: 14.5