Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E371224

Search information 
Request: 371224Match: SGN-E371224
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178269Clone name: TUS-28-L11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178269 is on microarray TOM1 spot ID 1-1-6.4.4.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65089 [cLEM-8-E5] Trace: SGN-T85313 EST: SGN-E271762 Direction: 5' Facility: TIGR
Clone: SGN-C178269 [TUS-28-L11] Trace: SGN-T183583 EST: SGN-E371223 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371224Length: 691 bp (906 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E371224 [] (trimmed) GCAGGTTTCTCTCTCAATAGATCCCTCATTCTAAAAGCTCTTTTCAGGGATCATCATCAAGGAAGCGTGATGGGGCTCACATTCACCAAGCTCTT
CAGTCGGCTTTTCGCCAAGAAGGAAATGCGCATTCTAATGGTTGGTCTTGATGCAGCTGGTAAGACCACCATATTGTACAAGTTGAAGCTGGGAG
AGATCGTGACTACTATTCCTACCATTGGTTTCAATGTGGAGACTGTTGAGTACAAGAACATCAGCTTCACTGTTTGGGATGTCGGAGGTCAGGAC
AAGATCCGTCCATTGTGGAGGCACTACTTCCAGAACACTCAGGGTCTCATTTTTGTGGTTGATAGCAATGATAGAGACCGTGTTGTAGAAGCAAG
AGATGAATTGCATAGGATGTTGAACGAGGATGAACTTCGGGATGCTGTGCTTCTAGTATTTGCTAACAAACAAGATCTTCCTAACGCAATGAATG
CTGCTGAAATAACTGATAAGCTTGGACTGCACTCCCTCAGGCAGCGTCACTGGTACATCCAGAGCACTTGTGCAACTTCTGGCGAGGGGCTTTAT
GAGGGACTTGATTGGCTTTCTAACACATTGCTAACAAGGCTTAAAGTGATGCAGATTTGTTATTGTGGGTTGATCCTGGATGCAGGCGGAGTTTT
ATCTAGTTTTTTTTACTTCTCATGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371224] SGN-U580248 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183584 [Download][View] Facility Assigned ID: FA0AAD16CF06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5