EST details — SGN-E371623

Search information 
Request: 371623Match: SGN-E371623
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178728Clone name: TUS-29-O14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178728 is on microarray TOM1 spot ID 1-1-3.3.4.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70559 [cLER-15-D3] Trace: SGN-T95363 EST: SGN-E282843 Direction: 5' Facility: TIGR
Clone: SGN-C178728 [TUS-29-O14] Trace: SGN-T183951 EST: SGN-E371622 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371623Length: 623 bp (897 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E371623 [] (trimmed) TAACCTAAAAAATAAAAGATGGCTTCTAACACATTGATGAGTTATGGAATTGCACCTGTTTACCCCTCTATTCTCTCTTCTTCCAAGTCTAAATT
CGCCACCGCGTTGCCGGTATCCACCGGAGTTACCAACGACACGTCAAGGTTCAGTATGTCGGCCAATTGGATGCCCGGGCAGCCCCGTCCATCCT
ACCTCGACGGCTCAGACCCCGGAGATTTCGGATTTGATCCACTTGGTTTTGGAGAAGTACCAGAAAATTTGGAAAGATACAAAGAATCTGAACTT
ATTCATTGCAGATGGGCTATGCTTGCTGTTCCAGGGATCATAGTACCAGAGGCATTGGGCTTAGGTAATTGGGTCAAGGCCCAAGAGTGGGCAGC
CATTCCTGGTGGACAAGCTACATATTTGGGCCAGCCTGTTCCATGGGGAACACTTCCTACTATTTTGGCTATTGAATTTTTAGCCATAGCCTTTG
TAGAACACCAAAGGAGTATGGAAAAAGATTCAGAAAAGAAGAAGTACCCTGGTGGGGCTTTTGACCCATTGGGTTACTCTAAAGACCCTGCTAAA
TTTGAAGAACTCAAAGTCAAGGAAATCAAGAATGGTCGTCTTGCATTGTTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371623] SGN-U579166 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183952 [Download][View] Facility Assigned ID: FA0AAD17BH07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5