EST details — SGN-E371679

Search information 
Request: 371679Match: SGN-E371679
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178668Clone name: TUS-29-M2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178668 is on microarray TOM1 spot ID 1-1-7.1.4.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72345 [cLER-1-O17] Trace: SGN-T92082 EST: SGN-E280528 Direction: 5' Facility: TIGR
Clone: SGN-C72345 [cLER-1-O17] Trace: SGN-T92083 EST: SGN-E280529 Direction: 3' Facility: TIGR
Clone: SGN-C178668 [TUS-29-M2] Trace: SGN-T184009 EST: SGN-E371680 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371679Length: 452 bp (861 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371679 [] (trimmed) GACAAAAATTTCAATTTGGTATCATATTTCATTCAATGAATTTCCTTCAAAACTACAGCAAAAATATAAAAGAAAGCCAGCAATGGCGATTAGCA
AAACAATTATTGAAATATCGATAACAAGTACTTTGTCTCGTCTCAAATAAACTTCATTACTGAAAATTTATTCATCAACAGGCCGCTGTCCAAGA
ACTGAAATATCCTCGTAACGCTTCCCAACATTGTTCTTCTCCCAGAGAGTTTTAACGCCATAATCCACTGCCCGTTCGCCGAGCAAAGCGCCGGC
GATGACAAAGGTAACATAGACAGGGGTACGGCGCATAACCAGCCTGTAAAATCCTTCAAGAACACCACCACCACTTCTTCTAGCAGCTGATTCCA
TTTTCTGAGCTTAAAATCCCTTCTGGGTTTCGCTTAGATTTGCTAATTTGTAGAGAAAACAGATGAATTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371679] SGN-U570518 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184008 [Download][View] Facility Assigned ID: FA0AAD17BG01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5