EST details — SGN-E372453

Search information 
Request: 372453Match: SGN-E372453
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179840Clone name: TUS-32-M22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179840 is on microarray TOM1 spot ID 1-1-3.1.1.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80987 [cLET-13-P7] Trace: SGN-T105833 EST: SGN-E293990 Direction: 5' Facility: TIGR
Clone: SGN-C179840 [TUS-32-M22] Trace: SGN-T185949 EST: SGN-E372454 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372453Length: 521 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372453 [] (trimmed) AACCAAAATCATGGATTGGTTTTTGGGGGAAGGAAATAATTACCACTACATGAAAACTTCAATGTTTAGGTCAACAATTTATTTTTCACAAAATG
AAATTTTTCAACAACCAAGTAAATCACCCCCTGCCCTTTAATGATCCCAACCTTTTGTCCATAATTGATGGTTGAGTTCCTAAGTAGTTTGTTTG
AATGAATTTGCTTTCAACATCATTTACTTGTAAATTTGCAAATAAAAATCCCCTTTTTTTTTATTCCCTCCCCCCCAATAAACTCCCCATTTTCA
ATTTTTGAAATTCCCCTAAAAACTTTTTTTTGACAGGGGGTCCCTTTTAAATCTGCCTTTAATATCCCTTCCTGAATCAAAGGAAGTGCCAAACT
TTTGGTGGAAGTTTGAGGAAGTGTCAATTTTTTAGGCTTATTTTGGAGTTTGAGTTTAAAAAGCTCCTTTTTACCCCAAAAAACCCTTCCCCCCG
GGGGATCCACTTTTTTTAAAGCGGCCCCCACCCCGGGGGACCTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372453] SGN-U597117 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185948 [Download][View] Facility Assigned ID: FA0AAD20BG11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.871 Expected Error Rate: 0.0219 Quality Trim Threshold: 12.5