EST details — SGN-E372592

Search information 
Request: 372592Match: SGN-E372592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179355Clone name: TUS-31-I17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179355 is on microarray TOM1 spot ID 1-1-8.1.2.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77422 [cLES-20-O12] Trace: SGN-T102234 EST: SGN-E290555 Direction: 5' Facility: TIGR
Clone: SGN-C179355 [TUS-31-I17] Trace: SGN-T185048 EST: SGN-E372591 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372592Length: 354 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E372592 [] (trimmed) GGTACAACAGTTGGCCTGTTAATATGATTTATTTTGCCGATGTTGTCTAATTACGCCTTGTCTTATGCTACTACAAATCATGATCATTGGTTGAA
ATAACCTAAGACCAATTTTCCAACTTATGGCTGCTTTGAGCACTCTGTAACAACTTGGGAGAATCCGAAGACTCCAAGCTTTTAAGAGCTTGCCC
ACGAAGACATGTTTGGTGATCTTTTCTTGGGTGTCTTATTACTCCCTGCACTTACTCTTGATTCTGATGACTTCTCCTTTGGAGTCAGATTTTCT
AGATGCTCCAATATCTTTGCAGCTGTCTCACTGGGATCGGAAGAGATGTGAGCATACCTTGTCGGAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372592] SGN-U595007 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185049 [Download][View] Facility Assigned ID: FA0AAD19AE09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0398 Quality Trim Threshold: 14.5