EST details — SGN-E372714

Search information 
Request: 372714Match: SGN-E372714
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179558Clone name: TUS-32-B4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179558 is on microarray TOM1 spot ID 1-1-5.2.1.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82401 [cLET-1-M9] Trace: SGN-T102406 EST: SGN-E292132 Direction: 5' Facility: TIGR
Clone: SGN-C179558 [TUS-32-B4] Trace: SGN-T186196 EST: SGN-E372715 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372714Length: 478 bp (862 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372714 [] (trimmed) AACGCCAATATAAAATTATTGATAGTCAAAGGCACCACAATACAGGTCAGTATATATTGGAAAGGAGCAAGTGCCCCGGTCCTAATTCATTCAGT
CAACAAAAAAACATCCCAAAAGTTAACAAAAACGTAACACTATTTGAACTTAAAACAACACCAAACCAAGCCATGGATAAGGGCTTTTTAATACT
AGGAGGAAAAATATCACATCCTCACTTTTTTCCGCTTTTTTTCAAGCCAGTACCGCCAATGGACCCTTTCTGAGCCTTTGCCTTGAGCTCCTTCA
GGGCCTTTTCTTTTTCCTTTTTTTTTGCAAGAAAAGCCTTGTCATTCTCATCATACTCCTTCTTTTCAGTCTTTGGTGCCTTCAAAGGCTTTGCT
TTTCCACCTTGCTTGGAAGACATGGTTGATTTTTAGGGTTAAAAGTTTGGATCTGTTGATGAAAACTCTCTCTCCTAACCCAAATAAGCTTTTTT
TTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372714] SGN-U578177 Tomato 200607 Build 2 78 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186195 [Download][View] Facility Assigned ID: FA0AAD20DA02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0047 Quality Trim Threshold: 12.5