EST details — SGN-E373131

Search information 
Request: 373131Match: SGN-E373131
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179537Clone name: TUS-32-A7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179537 is on microarray TOM1 spot ID 1-1-2.1.1.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82367 [cLET-1-L20] Trace: SGN-T102525 EST: SGN-E292251 Direction: 5' Facility: TIGR
Clone: SGN-C179537 [TUS-32-A7] Trace: SGN-T185795 EST: SGN-E373132 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373131Length: 646 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373131 [] (trimmed) GATTGATTGATAAAATTTTTTATATGGACCAAATATTACAAACTATGATGATCCTCAATCTGATCTCATCTTATTAATCTGATTCAAAGCTGGTT
GTAGAATGTTGTAAGCTACCCAAAGCAAAGCAGGTGTTACAACAATCAGCAAAAGTTGTCCCCTGTTATCACTTGCTGATTCTGCAATCGTGGCG
ATATCGGTAGCAGCAGAGGCTTCTGGAGTGTTAAAGAAGCCTGTTGCTGCAAGCCCTGTAAGACCAAGCCCGATTATAACTCCTTGATTCCTCAT
TTTGTTGATTTGGTTTAGTGCTGGTTGAAGAATGTTGTAAAGAACCCAGGCTAGAGCCGGGATCAATGGTAGCAACAGTGCTAATCCCCTGTTAT
CTCCTCCTTCAGCTAATTCTGCGATTTGTTGAGCTGCAAATGCGGAGTCACATGAGCTTAGGGTAGAGAAAACGGCACCTGCAATTGCGGTTCCA
GTGAGTGGGATGGATAAATTTGAGGGCTTTGAAGTTAAGAGACCTTTGGGGAGGTTGTGGATGGAGAGAAGAGAGATGGGTTTTGGCTTTGATGG
GTTGTTAATAGATGCTTTGGTGAAGCATTTGGCGTTGAGGACGGCCATGGTAGCTATGGTGGCTGCCATTTTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373131] SGN-U581010 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185794 [Download][View] Facility Assigned ID: FA0AAD20AA04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0