Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E373347

Search information 
Request: 373347Match: SGN-E373347
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179337Clone name: TUS-31-H23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179337 is on microarray TOM1 spot ID 1-1-2.4.2.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77388 [cLES-20-M21] Trace: SGN-T102024 EST: SGN-E290345 Direction: 5' Facility: TIGR
Clone: SGN-C179337 [TUS-31-H23] Trace: SGN-T185484 EST: SGN-E373346 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373347Length: 688 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373347 [] (trimmed) ATTATATCTTCCCAGCAACATTAATGGCTACTCCAAGTGTACAAGAAATTCGTCCTGCATCTCTTGATTCTACTTCCGAATCGCCAGCCCTGTTT
GATGGAACTACAAGGTTGTATATCAGTTATGTATGCCCTTTTGCACAGCGTCCATGGATTGCCAGAAATTTCAAGGGTTTGCAAGATAAGATCGA
ATTAGTTCCAATTGATCTTCAGAACAGGCCTGTTTGGTACAAGGAAAAAGTTTACCCTCAAAATAAGGTGCCCTCTCTGGAACACAACAACAAAG
TGATTGGAGAAAGTCTCGATCTGGTTAAATATATCGACAGCAACTTTGAGGGTCCGTTTCTTCTACCTGATGACCCTGAAAAACAGAAGTTTGCT
GAAGAGTTGATAGCTTACAGTGATACGTTCCTGAAAGAAATATATGCCAACTTCAAAGGAGATATTGAAAAGCATGCTGGACCTCAATTTGACTA
CTTAGAAAAAGCTCTCGACAAATTTGATGACGGACCTTTCTTCCTAGGTCAATTCAGTCAGGTCGATATCGTGTATGCTCCCTTCGTTGAAAGGT
TCCAAATCTTCTTGAAAGAGGGGTTAAATTATGATATCACATCTGGGAGGCCAAAACTAGCAAAATGGACAGAGGAACTGAACAAGCTTGATAGC
TACATTCAAACAAAAGCTGATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373347] SGN-U586347 Tomato 200607 Build 2 39 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185485 [Download][View] Facility Assigned ID: FA0AAD19CD12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5