EST details — SGN-E373368

Search information 
Request: 373368Match: SGN-E373368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179429Clone name: TUS-31-L19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179429 is on microarray TOM1 spot ID 1-1-6.4.2.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82225 [cLET-1-E5] Trace: SGN-T102349 EST: SGN-E292075 Direction: 5' Facility: TIGR
Clone: SGN-C82225 [cLET-1-E5] Trace: SGN-T102350 EST: SGN-E292076 Direction: 3' Facility: TIGR
Clone: SGN-C179429 [TUS-31-L19] Trace: SGN-T185507 EST: SGN-E373369 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373368Length: 402 bp (882 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373368 [] (trimmed) CATTCTTAAATTTGCGTGAATATTAATTAAGTTACATGATAGAGCAAGCATTAGGATTGTTATCACTGAAAATTTGAGGAGAATAATTAGCGTAG
TACTCCATGTTGTTGTTGTAGTACTTTTGAGCTAAATTATAATCCTTAATAATATATTCTTCTTTTTCTTCCTCCTTCTCTTCTTCTTCTTCTTT
CTCTTGAATAATATTATTTACGAGTGAAGCTTGTTTTCCGCTTCTCTTATTCACTTCTTTAGTTAACTTTTCTGGGTCGATATTGAAACCTTTTA
TAATTACTTGACTTTTTTCAATATCTGTCGTAACACATTCTACACCTTTGATTTTGCGGATTTGCTTCTGAAGAACTTGAGCACAAGCATCACAA
TGTCTCTCTCTCTCCCTGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373368] SGN-U563665 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185506 [Download][View] Facility Assigned ID: FA0AAD19CF10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0050 Quality Trim Threshold: 12.5