EST details — SGN-E373452

Search information 
Request: 373452Match: SGN-E373452
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179420Clone name: TUS-31-L10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179420 is on microarray TOM1 spot ID 1-1-7.4.2.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82212 [cLET-1-E14] Trace: SGN-T102433 EST: SGN-E292159 Direction: 5' Facility: TIGR
Clone: SGN-C179420 [TUS-31-L10] Trace: SGN-T185589 EST: SGN-E373451 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373452Length: 662 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373452 [] (trimmed) AAGAGAGAAGAAGCAATATGGCTTCCTCTGTCATTTCTTCAGCAGCTGTTGCCACACGCAGCAATGTTACACAAGCTAGCATGGTTGCACCTTTC
ACTGGTCTCAAATCTTCAGCCACTTTCCCTGTTACAAAGAAGCAAAACCTTGACATCACTTCCATTGCTAGCAATGGTGGAAGAGTTAGCTGCAT
GCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACACTCTCATACCTTCCTGATTTGTCTGACGAGCAATTGCTTAGTGAAATTGAGTACC
TTTTGAAAAATGGATGGGTTCCTTGCTTGGAATTTGAGACTGAGCACGGATTTGTCTACCGTGAGAACAACAAGTCACCAGGATACTATGATGGA
AGGTACTGGACCATGTGGAAGTTGCCTATGTTTGGGTGCACTGATGCAACCCAAGTGTTGGCTGAGGTTCAAGAGGCTAAAAAGGCATACCCACA
AGCATGGGTCAGAATCATTGGATTCGACAATGTGCGTCAAGTGCAGTGTATCAGTTTCATTGCCTACAAGCCAGAAGGCTACTAAGTTTCATATT
AGGAACAAAATTGTCTTTAGGGACACTTTGTTTTTAAATGCTACTTANGTCTTTTTTTCTTTTTTGTCTTATTTCAACAAACTCTTTGTGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373452] SGN-U578689 Tomato 200607 Build 2 989 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185590 [Download][View] Facility Assigned ID: FA0AAD19DF05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0143 Quality Trim Threshold: 12.5