EST details — SGN-E373642

Search information 
Request: 373642Match: SGN-E373642
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180216Clone name: TUS-33-M14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106576 [cLPP-2-J7] Trace: SGN-T173887 EST: SGN-E363027 Direction: 5' Facility: TIGR
Clone: SGN-C180216 [TUS-33-M14] Trace: SGN-T186606 EST: SGN-E373641 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373642Length: 669 bp (941 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373642 [] (trimmed) CGCAAATAATTTTTTAAATCTAGTGCTCTGGCACTAGATATAAAAATACGCCATTAAAACTCCTTGTCTTTTATTTCTATAGCTCTCTTCCTCAA
AAAATCCTATAAAACTCTCAAAATTCCGAAGCACCAATTTCAATATAAATATTAGGTCATGGATAATAACATGCAACAAGCTGCTGTGATGAATA
ATAACATTCAACAACCTCCTGTTAGTCTCCCAACCCCTCAAGGTTATCCTCCACAAGCTTACCCAAATGGGATGTATCCTCCCCCACAAGTATAT
ACTCCCCAGGCCCAAGGGCATGGATACCCACAAGGAGTAGGATATTACCCTCCTCACCCCCAACCCCAAGGTTATCCTCCGCCCATCGGAATGGG
ATATCCACCACAAGGTTACCCTCCACAAAGTTGTCATCCTCCACAATATGGTGCACCCCCACAAGGGCAAGGATATCCTCCTCAAAAACAAAAAC
AAAATCAAGCTGCTACTGGTGTCATGGGAGGATGTTTGGCTGCTTTGTGTTGCTGTTGTCTCTTAGATGCATGTCTTGAATGAAGGATCAATGAT
TTATTTTTTTTAACCGCAAGTGATCTACAACAGAAGGTGATTCCCAGCTATAGGGTTGAAGTAAAGATCATCGAAGAATCTCGTGAAGGTCATAT
CCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373642] SGN-U565098 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186607 [Download][View] Facility Assigned ID: FA0AAD21BG07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5