Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E373917

Search information 
Request: 373917Match: SGN-E373917
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179935Clone name: TUS-33-A21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86957 [cLET-44-N24] Trace: SGN-T111529 EST: SGN-E298893 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373917Length: 508 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E373917 [] (trimmed) CATAAGAAATAGTTTGATCTTGTAAATATAATGTGACTAACTGACAAAGTAGGTTCGAAAGAGTGACTTGTTGAAATTGCATTATTTAATGAAAA
TGTTGACTCTCTTAATGAAATGTATATATTGACTTTTAATTTTTAGTGAAAATGTTGGCTTTGCTTGTGCCAGAGATTTTTAGGCATCATAATTT
TCTGATAATCTAACTTGAAATAAGAAATATACTAATTGCTATTGAAATATTTTTTTTTACAGCCTTTGAAACTCTCATGGCACGAAAAGAAATTG
ATAGACTATAAGTCACAGAACTTCTAAAGGAATTTGAATCCGACTTGATGTGCAAAGGAAAATTAAGTTGGCCAGAACTTATTGGTGTACCAGCA
CAATATGCTAAGGGAATAATTCAGAAGGAAAATCCATTCGTAACTGATGTTCAAATAGTATTGAATGGTTCTCCAGTCACAGCTGATTTTACGTG
TTATCGAGATCGTATTGATGTAAACATTTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373917] SGN-U593094 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186369 [Download][View] Facility Assigned ID: FA0AAD21AA11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5