EST details — SGN-E374034

Search information 
Request: 374034Match: SGN-E374034
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180073Clone name: TUS-33-G15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93245 [cLEX-14-C12] Trace: SGN-T118066 EST: SGN-E305580 Direction: 5' Facility: TIGR
Clone: SGN-C180073 [TUS-33-G15] Trace: SGN-T186485 EST: SGN-E374033 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374034Length: 430 bp (934 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E374034 [] (trimmed) GGTTTTCTTCCTCTCTCTTCCAATCAACCCTAACTTTAGAGAGAGAAAGAAAAAGGCTACTCTTCCACCATGTTGGTTTATCAGGATCTCCTCAC
CGGTGATGAGCTTCTCTCTGACTCATTTCCCTACAAAGAAGTCGAGAATGGCGTGCTTTGGGAAGTTCAAGGGAAGTGGGTTGTTCAAGGTGCCG
TCGATGTAAACATTGGGGCAAATCCTTCTGCTGAGGGTGGATGTGAAGATGAAGGTGTGGATGACCAACCTGTCAGGGTTGTCGATATTGTTGAC
ACTTTTAGACTACAGGAGCAACCTGCTTTTGACTAGAAACATTTTGTTACCTTCATGAAGAGATACTTCAAGAGCCTGATACCCATGCTAGAAGG
AGAAACACAGGAAGCATTTAGAAACATCATTGAACCAGCAGCTAAGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374034] SGN-U592820 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186486 [Download][View] Facility Assigned ID: FA0AAD21AD08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5