EST details — SGN-E374173

Search information 
Request: 374173Match: SGN-E374173
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179947Clone name: TUS-33-B9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86995 [cLET-44-P23] Trace: SGN-T111351 EST: SGN-E298715 Direction: 5' Facility: TIGR
Clone: SGN-C179947 [TUS-33-B9] Trace: SGN-T186788 EST: SGN-E374174 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374173Length: 483 bp (939 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E374173 [] (trimmed) GACCAAATAATATACCGGAGGATAAGGCCAACCAATAAATCATTTCGACCCTTTTTCCCACATAAAACATGTACACCCTTTCTTCCAAAATAAAA
ACATCATCAGTTTACAGCATAATGGTCTATTCAAAAAACCAACATTTTCAGCAAGGGGATCTATCAGCCTTAAGTTCATGCCACAAACAAAACAA
TGTATCAAATAGGTCATTGTCGTCATCATTGTCACTATTTAGTCCACCATCCGTCTTCGAAATATCCAAAAAAGTCGTGAACCATTGCTCATGCA
GTGTTGAAAAGTTAGCTCTTTGTTCAAAAAACTTAAAACTTTCTCTGTTCATTTTCTCCATTACTTGCGCCGCACTCAATGCAAATTCAACCACA
GTTTTCGGTATTCCAGCCATAAGGGCTACTTGCATCCCATAGCTCTCCGGGCATGCTCCAAAGGTTAGGCGGTAAAGGAACACCAGTTCTTGCTC
TGTTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374173] SGN-U567784 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186787 [Download][View] Facility Assigned ID: FA0AAD21CA05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0052 Quality Trim Threshold: 12.5