EST details — SGN-E374448

Search information 
Request: 374448Match: SGN-E374448
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182054Clone name: TUS-38-J4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182054 is on microarray TOM1 spot ID 1-1-5.2.10.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83697 [cLET-25-L6] Trace: SGN-T108434 EST: SGN-E295709 Direction: 5' Facility: TIGR
Clone: SGN-C182054 [TUS-38-J4] Trace: SGN-T187719 EST: SGN-E374449 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374448Length: 747 bp (905 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E374448 [] (trimmed) AATATTGGATATTCAAGTAACGTTAAAAGAATATTTTTGTAATTGTTGTACATAGCGGTAACTAGAGTATGAAATAAAATTACAGTAACATTTCT
TCTTTATAATAATACACATATTCCCCTTATACTCCCATTAATTACCGAAAGTCTTCACATCACTCGAACGTTGATATGTAAAGATGTACAAAGAA
CACCAATGCAGCAAGAGTTGCAGATTTCCCCCTTATATTTTTTTGGGATGATATAGTTTTTTACAATATAAATAAACCAGAGGCCCCTACATTTT
CTTTTCTTTTGGTACATTGGGAGACTCAAAATAAACAAGAGCCCCTAGTATCCTTCACAAACACTGAAGAGGTCACCTAGAGGGGTCTGGTAACA
TATGCATCCTTTAGCAAGCAGGGATTGTAAATGCTGCTAGCTCGCGGCATGCTGCAATGGTGGCCATGCTATCTCATCATCATTTGTGTAACCAT
TGATAAGGAAGTCAGAGCAATTCTTCCGACATCCATGGTTATAGGGATTTCGGAACCTCCCATCTGGACCACGAAGATAACCATATCTCACAGCA
TTTGCCATCTCATTTGTTGTGAGATTCCGAGCTATCTGGGATATCTGTATTACACAGAGAGTTACAGAAGCAATTAGAATAACCCCATCCATGAA
CAGAAAAGCGATTATACCAGGATACGCAAAGAAAACATGATGTAACCACGATTCATCAGCTACCAACAATGGTACTGATGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374448] SGN-U568886 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187718 [Download][View] Facility Assigned ID: FA0AAD26DE02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5