EST details — SGN-E374667

Search information 
Request: 374667Match: SGN-E374667
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173331Clone name: TUS-15-N17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173331 is on microarray TOM1 spot ID 1-1-8.2.19.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2072 [cLEC-14-L24] Trace: SGN-T26526 EST: SGN-E204910 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374667Length: 684 bp (914 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E374667 [] (trimmed) AGCTATTATTGTGCTTCTAGGATTACTTGTCGTCACCAACATTCACATAACAGAGGCTCAAATAGGTGTTTGTTATGGAATGATGGGGAACAACT
TGCCATCACATTCTGAAGTTATACAGCTCTACAAGTCGAGAAACATTACAAGACTGAGGCTTTATGATCCAAATCATGGAGCTTTGAATGCGCTA
AGAGGATCAAACATTGAAGTGATATTAAGACTTCCAAATGTAAATGTGAAACACATTTCTTCTGGGATGGAACACGCGAGATGGTGGGTACAGAA
GAACGTTAGAGATTTCTGGCCTCATGTTAAAATTAAGTATATAGCTGTTGGTAATGAAATCAGCCCTGTTACTGGCACTTCCAATCTTGCCCCAT
TTCAAGTTCCTGCTTTGGTTAACATTTACAAAGCAATCGGTGAAGCTGGTTTGGGAAATGACATTAATGTCTCAACGTCTGTAGACATGACGTTG
ATTGGCAATTCTTATCCACCATCACAGGGTTCATTTAGGAACGATGTTATATGGTTTACTGATCCAATTGTTGGGTTTTTGAGGGATACACGTGC
ACCTTTGCTCGTTAACATTTATCCTTATTTTAACTATTCTGGTAATCCAGGACAGATTTCACTTTCGTATGCTCTTTTTACAGCACCTAATGTAT
TGGTACAAGATGGATCGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374667] SGN-U581016 Tomato 200607 Build 2 540 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188897 [Download][View] Facility Assigned ID: FA0AAD3CG09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5