EST details — SGN-E374822

Search information 
Request: 374822Match: SGN-E374822
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172994Clone name: TUS-14-P16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172994 is on microarray TOM1 spot ID 1-1-1.4.20.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14442 [cLEC-7-O9] Trace: SGN-T25407 EST: SGN-E202125 Direction: 5' Facility: TIGR
Clone: SGN-C172994 [TUS-14-P16] Trace: SGN-T188129 EST: SGN-E374821 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374822Length: 587 bp (905 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E374822 [] (trimmed) GAGAAGCTGAATTGAACTCTTCCCATTTTTCTCCGTTCATCCCCGCCGGAGCAATTTTTCCCATGGCGAAAACCTTAATTTCATCTCCATCATCG
TTCATCGGAACTCCTTTGCCGTCGCTTTCTCGCCATGTATTTCACCGGCGAAGACTTATCTCTACTAGAGTGAAATTCAGCTTCCATGACCTTCC
TCCGATTCACTCGCTTCACTCTAATTTTGATTTTGAAGCTGTTGTAAGCCGAGCGGAGGGACTTCTCTACACGTTAGCTGATGCTGCCGTCGCGG
CTGATCCTGGTGTTGCTCCCGATGTTACTGCTGCCGGTACTGCTCAGAAAAGTGGTGGTTGGTTTGCTTTCATTTCTGACGCCATGGAAGTTGAG
TTGAAGGTGATGAAGGATGGACTGCAAGCTGTGCATGTGCCTTATTCCTATGGATTCGCAATCATATTGCTTACTCTCCTGGTTAAAGCTGCCAC
TTTTCCTTTGACAAAGCAACAGGTTGAATCAACTTTTAGCAATGCATAATCTTCCAACCAAAGATCAAAAGCTATTCAACAAAAGATATGCTGAA
TATCAGGAGAGAATCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374822] SGN-U581345 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188130 [Download][View] Facility Assigned ID: FA0AAD2DH08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5