EST details — SGN-E375043

Search information 
Request: 375043Match: SGN-E375043
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181413Clone name: TUS-36-O11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181413 is on microarray TOM1 spot ID 1-1-6.3.14.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24012 [cLED-6-P17] Trace: SGN-T50078 EST: SGN-E233092 Direction: 5' Facility: TIGR
Clone: SGN-C181413 [TUS-36-O11] Trace: SGN-T187602 EST: SGN-E375044 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375043Length: 585 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375043 [] (trimmed) ACCATTGCATCAAATAGAAAAATAAAATGAAGCTTTAAATTGGATATGCACACTATGAGCATAGCTCTACATTAAAAAGCAAAATACATATATAC
AGCCTTTTCCCAAACATATAAAACAAAAATTATATATTAGGGTTTATCTATCAAAAAAATGGAAGACTGGGAACGTTCTCTGGCCGTTCACAATT
TGATCTTATCCACCCAATCTTTTGGTTAACGTTGTCATACACGAACAACTGGCCACGTAGGGAAATATCTCCAAGTATTATAGCAAAGCCATCGG
GAACGTTGCTTCCATCAAGTATACCTAAGCACACATTACTTTTTTCACTTATAGTCAAATACCCTTCTGCAGGAATCCAAAGCTTAGGGGACACG
ACACGCCACTTGCTTCCGAATTGAAGGTTTAGAGGTTTGAAAAATTGTCTAACCTCTTCAATAGATCTTACTGGAAATTTAGCTCGCCAGCAAAT
GGGTAATGTCGTATCTGATGCATCCTTGATAAGATCTTCACTGGAAATCTCTTCAAGCATGGAAATCAAAGCTTTGTATGCTTGATCTGTAAAAT
ATGTATAAGTACTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375043] SGN-U584523 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187601 [Download][View] Facility Assigned ID: FA0AAD24AH06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5