EST details — SGN-E375191

Search information 
Request: 375191Match: SGN-E375191
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180577Clone name: TUS-34-L15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180577 is on microarray TOM1 spot ID 1-1-2.4.19.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C31845 [cLEG-15-O8] Trace: SGN-T66750 EST: SGN-E251736 Direction: 5' Facility: TIGR
Clone: SGN-C180577 [TUS-34-L15] Trace: SGN-T187094 EST: SGN-E375192 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375191Length: 640 bp (926 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375191 [] (trimmed) ACTAGTTCCTCTGGTACCCCTTTGAATTTACATGATCCTCGCGTCTTGGCAATTGCAGAGGCTGAACGCCAACTTCTGGAAGCTGAATATGATGA
TTACAATTCTGCAAATGCAAGTGGTGCAGCTTTCTTTCGATCGGCTGCTTTAATTTTGATGGCTCTTCTACTATTGCGCCATGCATTACCAATGA
CAGATACAGATGGAGATGATGAAGATCCAACTGCTTTCTTTTCGCTTTTCTTACTCCGGGCAGTTGGCTTTCTTTTACCCTGCTACATCATGCTC
TGGGCCATCAGCATCTTGCAGCAGCGCAGACAAAGAGAGGAAGCTGCAGCATTGGCAGCAACACAATTTGCAGTTGTGTTACACTCTGGACAGCC
GAGAAGTGTACAGTTTACCATAGCTTCAGCTGCACCAGCAACACCAGCAGCGCCTGCTTCAGTGGATAATGTTTAAACAACAAGATGATCGTGCT
TGATCTCTTATTTTGAAGCTAAATACTGCCTTATGCTAGATTTGTTTGTCTGTTATCATATTTCATATATTATTATATGGGGAAGTTCGAAAATG
AATTGTTGTATTACCATTTTGCCCCCCTTTACTGTTTTAAAAATTTGATTAAATATAAATATTTTTAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375191] SGN-U573343 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187093 [Download][View] Facility Assigned ID: FA0AAD22CF08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0018 Quality Trim Threshold: 12.5