Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E375246

Search information 
Request: 375246Match: SGN-E375246
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180475Clone name: TUS-34-H9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180475 is on microarray TOM1 spot ID 1-1-8.4.19.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C31181 [cLEG-12-H11] Trace: SGN-T66214 EST: SGN-E252404 Direction: 5' Facility: TIGR
Clone: SGN-C180475 [TUS-34-H9] Trace: SGN-T187149 EST: SGN-E375247 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375246Length: 640 bp (953 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375246 [] (trimmed) ACTAGTTCCTCTGGTACCCCTTTGAATTTACATGATCCTCGCGTCTTGGCAATTGCAGAGGCTGAACGCCAACTTCTGGAAGCTGAATATGATGA
TTACAATTCTGCAAATGCAAGTGGTGCAGCTTTCTTTCGATCGGCTGCTTTAATTTTGATGGCTCTTCTACTATTGCGCCATGCATTACCAATGA
CAGATACAGATGGAGATGATGAAGATCCAACTGCTTTCTTTTCGCTTTTCTTACTCCGGGCAGTTGGCTTTCTTTTACCCTGCTACATCATGCTC
TGGGCCATCAGCATCTTGCAGCAGCGCAGACAAAGAGAGGAAGCTGCAGCATTGGCAGCAACACAATTTGCAGTTGTGTTACACTCTGGACAGCC
GAGAAGTGTACAGTTTACCATAGCTTCAGCTGCACCAGCAACACCAGCAGCGCCTGCTTCAGTGGATAATGTTTAAACAACAAGATGATCGTGCT
TGATCTCTTATTTTGAAGCTAAATACTGCCTTATGCTAGATTTGTTTGTCTGTTATCATATTTCATATATTATTATATGGGGAAGTTCGAAAATG
AATTGTTGTATTACCATTTTGCCCCCCTTTACTGTTTTAAAAATTTGATTAAATATAAATATTTTTAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375246] SGN-U573343 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187148 [Download][View] Facility Assigned ID: FA0AAD22CD05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0029 Quality Trim Threshold: 12.5