Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E375247

Search information 
Request: 375247Match: SGN-E375247
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180475Clone name: TUS-34-H9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180475 is on microarray TOM1 spot ID 1-1-8.4.19.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C31181 [cLEG-12-H11] Trace: SGN-T66214 EST: SGN-E252404 Direction: 5' Facility: TIGR
Clone: SGN-C180475 [TUS-34-H9] Trace: SGN-T187148 EST: SGN-E375246 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375247Length: 595 bp (946 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375247 [] (trimmed) AATTAAAAATATTTATATTTAATCAAATTTTTAAAACAGTAAAGGGGGGCAAAATGGTAATACAACAATTCATTTTCAAACTTCCCCATATAATA
ATATATGAAATATGATAACAGACAAACAAATCTAGCATAAGGCAGTATTTAGCTTCAAAATAAAAAATCAAGCACGATCATCTTGTTGTTTAAAC
ATTATCCACTGAAGCAGGCGCTGCTGGTGTTGCTGGTGCAACTGAAGCTATGGTAAACTGTACACTTCTCGGCTGTCCAAAGTGTAACACAACTG
CAAATTGTGTTGCTGCCAATGCTGCAGCTTCCTCTCTTTGTCTGCGCTGCTGCAAGATGCTGATGGCCCAAAGCATGATGTAGCAGGGTAAAAGA
AAGCCAACTGCCCGGAGTAAGAAAAGCGAAAAAAAAGCAGTTGGATCTTCATCATCTCCATCTGTATCTGTCATTGGTAATGCATGGCGCAATAG
TAAAAGAGCCATCAAAATTAAAGCAGCCGATCGAAAGAAAGCTGCACCACTTGCATTTGCAGAATTGTAATCATCATATTCAGCTTCCAGAAGTT
GGCGTTCAGCCTCTGCAATTGCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375247] SGN-U573343 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187149 [Download][View] Facility Assigned ID: FA0AAD22CD05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0105 Quality Trim Threshold: 12.5