Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E375476

Search information 
Request: 375476Match: SGN-E375476
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180522Clone name: TUS-34-J8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180522 is on microarray TOM1 spot ID 1-1-1.2.19.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C33777 [cLEG-28-D12] Trace: SGN-T68622 EST: SGN-E253857 Direction: 5' Facility: TIGR
Clone: SGN-C180522 [TUS-34-J8] Trace: SGN-T187245 EST: SGN-E375477 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375476Length: 731 bp (933 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375476 [] (trimmed) GACATAAGGTGTCAAGATGAGAACAAACCTTGGCCTTCCTGCCAGAGGCATCAACACCATCTTGCAAGTTCAAGCCTCCATTAATTCCTAATTTA
CACATTAATTGTGTATCATCGAATGTATTATTACATGATATTTTAATAAAAATTGGTAATAAAATAATTACTATTTATCATAATTCGTCAAATTA
CTAGCTACAAAGATTCATTAGTGCAAAAATAAAATAAAAATTATTAACGTTGGGAGATGAAAGACCTCATATATTAACAAGAATTTACAAATCTA
ACGAAAGATTTACACATTGCAAAGTAAATACTATTCAATATCGAATATGAGAAACCTCATATATTGGCAATAGCTTATTAATTTGAAGAAAAAAT
TAAACAAATCAAGAAAAATAATTATAGAATAAATTCATACAAATTAAGAAAAACAATCCAATAACTACAAAAATCTCTCTCCAAGTTGATGTATA
TTACTACTAGAGTATGACATTTTTTTATTTTTTTTTATGTAAGATCAAATAGTTGGAATTTTTTAAGGTGGACCACATTATCACTTTATTTCAGA
GTCGATTAATCTCTAGATCACATCCTAACTAGAAATATCTTAACAGCTAGAAGAAGAGAAAAATTATTTATATTCAAAACTCTCTTTCCTTCCTT
GCTACTATAATTAAAAATTGCAAAACTTACTCGAAAATGAAGGTCATTAATCCAATAAATGTATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375476] SGN-U580072 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187244 [Download][View] Facility Assigned ID: FA0AAD22DE04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.893 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5