EST details — SGN-E375593

Search information 
Request: 375593Match: SGN-E375593
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180680Clone name: TUS-34-P22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180680 is on microarray TOM1 spot ID 1-1-3.4.19.15 [Order] [Tomato Microarray Database]
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C34409 [cLEG-30-M5] Trace: SGN-T69037 EST: SGN-E255311 Direction: 5' Facility: TIGR
Clone: SGN-C180680 [TUS-34-P22] Trace: SGN-T187360 EST: SGN-E375592 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375593Length: 530 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375593 [] (trimmed) AGTCAAGGAGATCATACTAAAATTTGGCAAGAGTACAAGAGAGAAAATAAAAGGTACTGAATACAAAATCACATATCCCCAAAATTGGAATTACA
ACAATAGAGAACCATATGAAACTAGTCTGATTGCACCAGTTAAGCAGCAGCACCAGCTCCACTTTTGCCTTTCTTCTTCTGTAGTTTCTTCATGT
AGAACTCAAGCTCTTTTCCCTCCAAAATGTACCCATCACATCTGCCACATTGACCAGGGCGTGAAGAGATGCAGGCCAAAAGCCTACAAAAGTAG
GGTTTTCTTGCAAACACATCGCGCAGCCTCGCTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACCCAAAGAACTACGGCCCTGGC
TCTCGCACATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAGACAGTGCTTTCGCAGCAATGCCAAGGA
AATTGGCTTCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375593] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187361 [Download][View] Facility Assigned ID: FA0AAD22DH11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0101 Quality Trim Threshold: 12.5